TALEN

TALEN1-tesmin

ID

ZDB-TALEN-220829-1

Name

TALEN1-tesmin

Previous Names

None

Target

tesmin (1)

Target Sequence 1

5' - ATTGGTGACAGAGTCTCATTGC - 3'

Target Sequence 2

5' - TGTCAGGAACAAACCGTCTTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3606	tesmin

Expression

Gene expression in Wild Types + TALEN1-tesmin

No data available

Phenotype

Phenotype resulting from TALEN1-tesmin

No data available

Phenotype of all Fish created by or utilizing TALEN1-tesmin

Phenotype	Fish	Conditions	Figures
hypothalamus agrp expression increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	control	Fig. 4 from Zhao et al., 2022
hypothalamus agrp expression increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	increased food availability	Fig. 4 from Zhao et al., 2022
blood plasma insulin increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	control	Fig. 8 from Zhao et al., 2022
brain ghrh expression increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 5 from Zhao et al., 2022
liver glycogen decreased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 8 from Zhao et al., 2022
female organism increased length, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 5 from Zhao et al., 2022
liver ghrb expression increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 5 from Zhao et al., 2022
blood plasma glucose increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	increased food availability	Fig. 8 from Zhao et al., 2022
hypothalamus cart1 expression decreased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	increased food availability	Fig. 4 from Zhao et al., 2022
liver g6pc1a.1 expression decreased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 8 from Zhao et al., 2022
liver igf2b expression increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 5 from Zhao et al., 2022
blood plasma glucose decreased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	control	Fig. 8 from Zhao et al., 2022
adult feeding behavior decreased process quality, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 4 from Zhao et al., 2022
visceral fat increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 7 from Zhao et al., 2022
liver slc2a12 expression decreased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 8 from Zhao et al., 2022
liver igf1 expression increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 5 from Zhao et al., 2022
liver lipid droplet increased distribution, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 7 from Zhao et al., 2022
female organism increased weight, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 5 from Zhao et al., 2022
liver fatty acid synthase activity increased process quality, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 6 from Zhao et al., 2022
blood plasma triglyceride increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 6 from Zhao et al., 2022
liver pck1 expression decreased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 8 from Zhao et al., 2022
liver fasn expression increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 6 from Zhao et al., 2022
male organism increased weight, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 5 from Zhao et al., 2022
liver pfkla expression decreased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 8 from Zhao et al., 2022
hypothalamus cart1 expression decreased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	control	Fig. 4 from Zhao et al., 2022
periventricular nucleus agrp expression increased distribution, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 4 from Zhao et al., 2022
liver slc2a2 expression decreased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 8 from Zhao et al., 2022
liver triglyceride increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 6 from Zhao et al., 2022
liver glucose-6-phosphatase activity decreased process quality, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 8 from Zhao et al., 2022
liver gck expression increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 8 from Zhao et al., 2022
male organism increased length, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 5 from Zhao et al., 2022
hypophysis gh1 expression increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	standard conditions	Fig. 5 from Zhao et al., 2022
blood plasma insulin increased amount, abnormal	tesmin^{zf3606/zf3606} (AB)	increased food availability	Fig. 8 from Zhao et al., 2022

Citations