Morpholino

MO1-cep128

ID
ZDB-MRPHLNO-180719-1
Name
MO1-cep128
Previous Names
  • cep128_splx1 (1)
Target
Sequence
5' - TAAAGACATCTTACCTGGAGAGTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cep128
Phenotype
Phenotype resulting from MO1-cep128
Phenotype Fish Figures
heart development disrupted, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
liver decreased size, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
margin eve1 expression decreased amount, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
notochord bent, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
notochord increased thickness, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
notochord tbxta expression spatial pattern, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
pancreas decreased size, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
shield gsc expression increased distribution, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
shield chrd expression increased distribution, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
somite decreased thickness, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
somite elongated, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
tail bud tbxta expression spatial pattern, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
whole organism Ab12-smad labeling decreased amount, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
whole organism Ab11-smad2 labeling decreased amount, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
whole organism dorsalized, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
whole organism mixl1 expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism chrd expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism eve1 expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism sox17 expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism smad7 expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism gsc expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism nog1 expression increased amount, abnormal AB/TL + MO1-cep128 Fig. S3 with image from Mönnich et al., 2018
whole organism ovate, abnormal AB/TL + MO1-cep128 Fig. 2 with image from Mönnich et al., 2018
Phenotype of all Fish created by or utilizing MO1-cep128
Phenotype Fish Conditions Figures
whole organism mixl1 expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
pancreas decreased size, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
whole organism chrd expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
margin eve1 expression decreased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
shield gsc expression increased distribution, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
heart development disrupted, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
somite elongated, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
shield chrd expression increased distribution, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
whole organism Ab12-smad labeling decreased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
notochord bent, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
notochord increased thickness, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
whole organism dorsalized, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
tail bud tbxta expression spatial pattern, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
whole organism Ab11-smad2 labeling decreased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
liver decreased size, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
whole organism nog1 expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
whole organism eve1 expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
whole organism smad7 expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
notochord tbxta expression spatial pattern, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
whole organism gsc expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
whole organism ovate, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
somite decreased thickness, abnormal AB/TL + MO1-cep128 standard conditions Fig. 2 with image from Mönnich et al., 2018
whole organism sox17 expression increased amount, abnormal AB/TL + MO1-cep128 standard conditions Fig. S3 with image from Mönnich et al., 2018
Citations