Morpholino

MO1-tbc1d23

ID
ZDB-MRPHLNO-171027-2
Name
MO1-tbc1d23
Previous Names
None
Target
Sequence
5' - CTTCCCCTACAGCATCCGCCATTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbc1d23
Phenotype
Phenotype resulting from MO1-tbc1d23
Phenotype Fish Figures
brain EGFP expression decreased amount, abnormal knu3Tg + MO1-tbc1d23 Fig. 1 with image from Huang et al., 2019
brain elavl3 expression decreased amount, abnormal WT + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
Fig. 1 with imageFig. 6 with image from Huang et al., 2019
brain decreased size, abnormal AB + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
brainstem decreased size, abnormal AB + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
brainstem morphology, abnormal rw0130aTg + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
Fig. 1 with imageFig. 6 with image from Huang et al., 2019
CaP motoneuron axon morphology, abnormal ml2Tg + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
caudal fin curved, abnormal WT + MO1-tbc1d23 Fig. S1 from Huang et al., 2019
cerebellum decreased size, abnormal AB + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
cerebellum morphology, abnormal WT + MO1-tbc1d23 Fig. 1 with imageFig. S1 from Huang et al., 2019
Fig. 4 from Marin-Valencia et al., 2017
eye decreased size, abnormal AB + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
forebrain morphology, abnormal WT + MO1-tbc1d23 Fig. 1 with imageFig. S1 from Huang et al., 2019
Fig. 4 from Marin-Valencia et al., 2017
fourth ventricle increased size, abnormal WT + MO1-tbc1d23 Fig. S1 from Huang et al., 2019
Fig. 4 from Marin-Valencia et al., 2017
midbrain decreased size, abnormal AB + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
midbrain morphology, abnormal WT + MO1-tbc1d23 Fig. 1 with imageFig. S1 from Huang et al., 2019
post-vent region increased curvature, abnormal AB + MO1-tbc1d23 Fig. 4 from Marin-Valencia et al., 2017
swimming behavior decreased occurrence, abnormal WT + MO1-tbc1d23 Fig. S2 from Huang et al., 2019
swimming behavior process quality, abnormal WT + MO1-tbc1d23 Fig. S2 from Huang et al., 2019
trunk gfap expression decreased amount, abnormal WT + MO1-tbc1d23 Fig. S1 from Huang et al., 2019
ventricular system increased size, abnormal WT + MO1-tbc1d23 Fig. S1 from Huang et al., 2019
whole organism EGFP expression decreased amount, abnormal knu3Tg + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
whole organism elavl3 expression decreased amount, abnormal WT + MO1-tbc1d23 Fig 6 with image from Liu et al., 2020
Fig. 1 with imageFig. 6 with image from Huang et al., 2019
Phenotype of all Fish created by or utilizing MO1-tbc1d23
Phenotype Fish Conditions Figures
brainstem decreased size, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
post-vent region increased curvature, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
brain decreased size, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
eye decreased size, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
brain elavl3 expression decreased amount, abnormal AB + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
midbrain decreased size, abnormal AB + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
cerebellum decreased size, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
fourth ventricle increased size, abnormal AB + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
whole organism elavl3 expression decreased amount, abnormal AB + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
fourth ventricle increased size, abnormal WT + MO1-tbc1d23 standard conditions Fig. S1 from Huang et al., 2019
whole organism elavl3 expression decreased amount, abnormal WT + MO1-tbc1d23 standard conditions Fig. 1 with imageFig. 6 with image from Huang et al., 2019
brain elavl3 expression decreased amount, abnormal WT + MO1-tbc1d23 standard conditions Fig. 1 with imageFig. 6 with image from Huang et al., 2019
midbrain morphology, abnormal WT + MO1-tbc1d23 standard conditions Fig. 1 with imageFig. S1 from Huang et al., 2019
caudal fin curved, abnormal WT + MO1-tbc1d23 standard conditions Fig. S1 from Huang et al., 2019
forebrain morphology, abnormal WT + MO1-tbc1d23 standard conditions Fig. 1 with imageFig. S1 from Huang et al., 2019
swimming behavior decreased occurrence, abnormal WT + MO1-tbc1d23 standard conditions Fig. S2 from Huang et al., 2019
ventricular system increased size, abnormal WT + MO1-tbc1d23 standard conditions Fig. S1 from Huang et al., 2019
swimming behavior process quality, abnormal WT + MO1-tbc1d23 standard conditions Fig. S2 from Huang et al., 2019
trunk gfap expression decreased amount, abnormal WT + MO1-tbc1d23 standard conditions Fig. S1 from Huang et al., 2019
cerebellum morphology, abnormal WT + MO1-tbc1d23 standard conditions Fig. 1 with imageFig. S1 from Huang et al., 2019
whole organism EGFP expression decreased amount, abnormal knu3Tg + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
brain EGFP expression decreased amount, abnormal knu3Tg + MO1-tbc1d23 standard conditions Fig. 1 with image from Huang et al., 2019
midbrain morphology, abnormal knu3Tg + MO1-tbc1d23 standard conditions Fig. 1 with image from Huang et al., 2019
forebrain morphology, abnormal knu3Tg + MO1-tbc1d23 standard conditions Fig. 1 with image from Huang et al., 2019
cerebellum morphology, abnormal knu3Tg + MO1-tbc1d23 standard conditions Fig. 1 with image from Huang et al., 2019
CaP motoneuron axon morphology, abnormal ml2Tg + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO1-tbc1d23 standard conditions Fig 6 with image from Liu et al., 2020
Fig. 1 with imageFig. 6 with image from Huang et al., 2019
cerebellum morphology, abnormal rw0130aTg + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
brainstem morphology, abnormal rw0130aTg + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
forebrain morphology, abnormal rw0130aTg + MO1-tbc1d23 standard conditions Fig. 4 from Marin-Valencia et al., 2017
Citations