Morpholino

MO2-prmt8b

ID
ZDB-MRPHLNO-130509-2
Name
MO2-prmt8b
Previous Names
  • MO2 (1)
Target
Sequence
5' - TGCTCTCCGCCTCCGCCATCTTTCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This translation-blocking Morpholino was designed to target a second AUG in prmt8b.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-prmt8b
Expressed Gene Anatomy Figures
myod1 Fig. 4 with image from Lin et al., 2013
otx2b Fig. 4 with image,  Fig. 6 with image from Lin et al., 2013
pax2a Fig. 6 with image from Lin et al., 2013
sox17 Fig. 4 with image from Lin et al., 2013
tbx6 Fig. 4 with image from Lin et al., 2013
Phenotype
Phenotype resulting from MO2-prmt8b
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO2-prmt8b Fig. S5 with image from Lin et al., 2013
axial mesoderm structural organization disrupted, abnormal WT + MO2-prmt8b Fig. 4 with image from Lin et al., 2013
brain malformed, abnormal WT + MO2-prmt8b Fig. 3 with image,  Fig. S1 with image from Lin et al., 2013
brain dorsal-ventral axis decreased length, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
brain neuron decreased amount, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
brain neuron disorganized, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
central nervous system neuron development disrupted, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
epiboly delayed, abnormal WT + MO2-prmt8b Fig. 3 with image from Lin et al., 2013
eye decreased size, abnormal WT + MO2-prmt8b + MO5-tp53 Fig. 3 with image,  Fig. S1 with image from Lin et al., 2013
germ ring increased thickness, abnormal WT + MO2-prmt8b Fig. 3 with image from Lin et al., 2013
heart edematous, abnormal WT + MO2-prmt8b + MO5-tp53 Fig. 3 with image,  Fig. S1 with image from Lin et al., 2013
midbrain decreased size, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
midbrain decreased width, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
notochord increased width, abnormal WT + MO2-prmt8b Fig. 4 with image from Lin et al., 2013
notochord shortened, abnormal WT + MO2-prmt8b Fig. 4 with image from Lin et al., 2013
post-vent region curved, abnormal WT + MO2-prmt8b Fig. 3 with image,  Fig. S1 with image from Lin et al., 2013
spinal cord neuron decreased amount, abnormal WT + MO2-prmt8b Fig. 6 with image from Lin et al., 2013
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-prmt8b Fig. 4 with image from Lin et al., 2013
yolk swollen, abnormal WT + MO2-prmt8b Fig. 3 with image,  Fig. S1 with image from Lin et al., 2013
Phenotype of all Fish created by or utilizing MO2-prmt8b
Phenotype Fish Conditions Figures
brain dorsal-ventral axis decreased length, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
yolk swollen, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
notochord shortened, abnormal WT + MO2-prmt8b standard conditions Fig. 4 with image from Lin et al., 2013
midbrain decreased size, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
epiboly delayed, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
midbrain decreased width, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
brain malformed, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-prmt8b standard conditions Fig. 4 with image from Lin et al., 2013
post-vent region curved, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
axial mesoderm structural organization disrupted, abnormal WT + MO2-prmt8b standard conditions Fig. 4 with image from Lin et al., 2013
notochord increased width, abnormal WT + MO2-prmt8b standard conditions Fig. 4 with image from Lin et al., 2013
brain neuron disorganized, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
germ ring increased thickness, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
heart edematous, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
eye decreased size, abnormal WT + MO2-prmt8b standard conditions Fig. 3 with image from Lin et al., 2013
brain neuron decreased amount, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
apoptotic process increased occurrence, abnormal WT + MO2-prmt8b standard conditions Fig. S5 with image from Lin et al., 2013
central nervous system neuron development disrupted, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
spinal cord neuron decreased amount, abnormal WT + MO2-prmt8b standard conditions Fig. 6 with image from Lin et al., 2013
brain malformed, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
heart edematous, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
post-vent region curved, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
eye decreased size, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
yolk swollen, abnormal WT + MO2-prmt8b + MO5-tp53 standard conditions Fig. S1 with image from Lin et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.