Morpholino

MO1-tbx5b

ID
ZDB-MRPHLNO-130123-3
Name
MO1-tbx5b
Previous Names
None
Target
Sequence
5' - GGATTCGCCATATTCCCGTCTGAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx5b
Expressed Gene Anatomy Figures
aimp1a Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
bmp4 Fig. 5 with imageFig. 7 with imageFig. 9 with image from Parrie et al., 2013
cox6b1 Fig. 3 with image from Boyle Anderson et al., 2018
cryba1l1 Fig. S5 with image from Boyle Anderson et al., 2018
ctsc Fig. S4 with image from Boyle Anderson et al., 2018
efnb2a Fig. 4 with image from Pi-Roig et al., 2014
ephb2a Fig. 4 with image from Pi-Roig et al., 2014
etv4 Fig. 5 with image from Pi-Roig et al., 2014
fgf10a Fig. 5 with image from Pi-Roig et al., 2014
fgf24 Fig. 5 with image from Pi-Roig et al., 2014
hand2 Fig. 5 with imageFig. 9 with image from Parrie et al., 2013
hey2 Fig. 7 with image from Parrie et al., 2013
hhex Fig. 3 with image from Boyle Anderson et al., 2018
hsp90aa1.2 Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
hspa8b Fig. S4 with image from Boyle Anderson et al., 2018
krt91 Fig. S5 with image from Boyle Anderson et al., 2018
mybphb Fig. S4 with image from Boyle Anderson et al., 2018
myl7 Fig. 2 with image from Pi-Roig et al., 2014
napbb Fig. S5 with image from Boyle Anderson et al., 2018
ndufa4b Fig. S5 with image from Boyle Anderson et al., 2018
nppa Fig. 5 with imageFig. 7 with image from Parrie et al., 2013
obsl1a Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
phlda2 Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
pvalb2 Fig. S4 with image from Boyle Anderson et al., 2018
ryr1b Fig. 4 with imageFig. S4 with image from Boyle Anderson et al., 2018
shha Fig. S3 with image from Steimle et al., 2018
si:dkey-204l11.1 Fig. S5 with image from Boyle Anderson et al., 2018
sox7 Fig. 3 with image from Boyle Anderson et al., 2018
tbx2b Fig. 7 with image from Parrie et al., 2013
tbx5a Fig. 5 with image from Pi-Roig et al., 2014
Fig. 7 with image from Parrie et al., 2013
tbx5b Fig. 7 with image from Parrie et al., 2013
tyrp1b Fig. S5 with image from Boyle Anderson et al., 2018
vcana Fig. 5 with imageFig. 9 with image from Parrie et al., 2013
Phenotype
Phenotype resulting from MO1-tbx5b
No data available
Phenotype of all Fish created by or utilizing MO1-tbx5b
No data available
Citations