Morpholino

MO1-smarcal1

ID
ZDB-MRPHLNO-100419-14
Name
MO1-smarcal1
Previous Names
  • smarcal1 MO1 (1)
Target
Sequence
5' - TTCTGGAGTCAGACTCACAGACATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smarcal1
Expressed Gene Anatomy Figures
ccna2 Fig. 6 from Huang et al., 2010
ccnb1 Fig. 6 from Huang et al., 2010
ccnd1 Fig. 6 from Huang et al., 2010
ccne1 Fig. 6 from Huang et al., 2010
cdkn1a Fig. 6 from Huang et al., 2010
cdkn1bb Fig. 6 from Huang et al., 2010
cdkn1ca Fig. 6 from Huang et al., 2010
gata1a Fig. 4 from Huang et al., 2010
gata2a Fig. 4 from Huang et al., 2010
hbbe1.1 Fig. 4 from Huang et al., 2010
lcp1 Fig. 4 from Huang et al., 2010
mpx Fig. 4 from Huang et al., 2010
runx1 Fig. 4 from Huang et al., 2010
spi1b Fig. 4 from Huang et al., 2010
tal1 Fig. 4 from Huang et al., 2010
Phenotype
Phenotype resulting from MO1-smarcal1
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO1-smarcal1 Fig. 5 with image from Huang et al., 2010
cell cycle process arrested, abnormal AB + MO1-smarcal1 Fig. 5 with image from Huang et al., 2010
ceratobranchial 3 cartilage aplastic, abnormal AB + MO1-smarcal1 Fig. S4 with image from Huang et al., 2010
ceratobranchial 4 cartilage aplastic, abnormal AB + MO1-smarcal1 Fig. S4 with image from Huang et al., 2010
ceratobranchial 5 cartilage aplastic, abnormal AB + MO1-smarcal1 Fig. S4 with image from Huang et al., 2010
ceratohyal cartilage decreased size, abnormal AB + MO1-smarcal1 Fig. S4 with image from Huang et al., 2010
embryonic morphogenesis disrupted, abnormal AB + MO1-smarcal1 text only from Huang et al., 2010
erythrocyte differentiation disrupted, abnormal AB + MO1-smarcal1 Fig. 3 with image from Huang et al., 2010
eye decreased size, abnormal AB + MO1-smarcal1 text only from Huang et al., 2010
head decreased length, abnormal AB + MO1-smarcal1 text only from Huang et al., 2010
head decreased size, abnormal AB + MO1-smarcal1 text only from Huang et al., 2010
heart edematous, abnormal AB + MO1-smarcal1 Fig. 3 with image,  text only from Huang et al., 2010
heart contraction decreased rate, abnormal AB + MO1-smarcal1 text only from Huang et al., 2010
hyosymplectic cartilage decreased size, abnormal AB + MO1-smarcal1 Fig. S4 with image from Huang et al., 2010
nucleate erythrocyte decreased amount, abnormal AB + MO1-smarcal1 Fig. 3 with image from Huang et al., 2010
palatoquadrate cartilage decreased size, abnormal AB + MO1-smarcal1 Fig. S4 with image from Huang et al., 2010
parachordal vessel aplastic, abnormal AB + MO1-smarcal1 Fig. S4 with image from Huang et al., 2010
subintestinal vein aplastic, abnormal AB + MO1-smarcal1 Fig. S4 with image from Huang et al., 2010
trunk decreased length, abnormal AB + MO1-smarcal1 Fig. 3 with image from Huang et al., 2010
whole organism pigment granule decreased amount, abnormal AB + MO1-smarcal1 Fig. 3 with image from Huang et al., 2010
Phenotype of all Fish created by or utilizing MO1-smarcal1
Phenotype Fish Conditions Figures
trunk decreased length, abnormal AB + MO1-smarcal1 standard conditions Fig. 3 with image from Huang et al., 2010
palatoquadrate cartilage decreased size, abnormal AB + MO1-smarcal1 standard conditions Fig. S4 with image from Huang et al., 2010
ceratobranchial 5 cartilage aplastic, abnormal AB + MO1-smarcal1 standard conditions Fig. S4 with image from Huang et al., 2010
parachordal vessel aplastic, abnormal AB + MO1-smarcal1 standard conditions Fig. S4 with image from Huang et al., 2010
subintestinal vein aplastic, abnormal AB + MO1-smarcal1 standard conditions Fig. S4 with image from Huang et al., 2010
eye decreased size, abnormal AB + MO1-smarcal1 standard conditions text only from Huang et al., 2010
whole organism pigment granule decreased amount, abnormal AB + MO1-smarcal1 standard conditions Fig. 3 with image from Huang et al., 2010
heart edematous, abnormal AB + MO1-smarcal1 standard conditions Fig. 3 with image,  text only from Huang et al., 2010
cell cycle process arrested, abnormal AB + MO1-smarcal1 standard conditions Fig. 5 with image from Huang et al., 2010
head decreased length, abnormal AB + MO1-smarcal1 standard conditions text only from Huang et al., 2010
nucleate erythrocyte decreased amount, abnormal AB + MO1-smarcal1 standard conditions Fig. 3 with image from Huang et al., 2010
heart contraction decreased rate, abnormal AB + MO1-smarcal1 standard conditions text only from Huang et al., 2010
ceratobranchial 3 cartilage aplastic, abnormal AB + MO1-smarcal1 standard conditions Fig. S4 with image from Huang et al., 2010
apoptotic process increased occurrence, abnormal AB + MO1-smarcal1 standard conditions Fig. 5 with image from Huang et al., 2010
hyosymplectic cartilage decreased size, abnormal AB + MO1-smarcal1 standard conditions Fig. S4 with image from Huang et al., 2010
erythrocyte differentiation disrupted, abnormal AB + MO1-smarcal1 standard conditions Fig. 3 with image from Huang et al., 2010
embryonic morphogenesis disrupted, abnormal AB + MO1-smarcal1 standard conditions text only from Huang et al., 2010
head decreased size, abnormal AB + MO1-smarcal1 standard conditions text only from Huang et al., 2010
ceratohyal cartilage decreased size, abnormal AB + MO1-smarcal1 standard conditions Fig. S4 with image from Huang et al., 2010
ceratobranchial 4 cartilage aplastic, abnormal AB + MO1-smarcal1 standard conditions Fig. S4 with image from Huang et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.