Morpholino

MO2-foxc1a

ID
ZDB-MRPHLNO-061111-2
Name
MO2-foxc1a
Previous Names
None
Target
Sequence
5' - CCTGCATGACTGCTCTCCAAAACGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-foxc1a
Phenotype
Phenotype resulting from MO2-foxc1a
Phenotype of all Fish created by or utilizing MO2-foxc1a
Phenotype Fish Conditions Figures
pronephric glomerulus lacks all parts of type pronephric glomerular capillary, abnormal AB + MO2-foxc1a standard conditions Fig. 4 from He et al., 2014
pronephric podocyte cell projection malformed, abnormal AB + MO2-foxc1a standard conditions Fig. 4 from He et al., 2014
podocyte development decreased process quality, abnormal AB + MO2-foxc1a standard conditions Fig. 4 from He et al., 2014
pronephric glomerulus lacks all parts of type pronephric podocyte slit diaphragm, abnormal AB + MO2-foxc1a standard conditions Fig. 4 from He et al., 2014
closure of optic fissure arrested, abnormal WT + MO1-foxc1a + MO2-foxc1a standard conditions Fig. 6 with image from Lupo et al., 2011
optic fissure closure incomplete, abnormal WT + MO1-foxc1a + MO2-foxc1a standard conditions Fig. 6 with image from Lupo et al., 2011
pericardium edematous, abnormal WT + MO2-foxc1a standard conditions Fig. 2 from Skarie et al., 2009
somitogenesis process quality, abnormal WT + MO2-foxc1a standard conditions Fig. 3 from Li et al., 2015
eye hemorrhagic, abnormal WT + MO2-foxc1a standard conditions Fig. 2 from Skarie et al., 2009
brain hydrocephalic, abnormal WT + MO2-foxc1a standard conditions Fig. 2 from Skarie et al., 2009
eye decreased size, abnormal WT + MO2-foxc1a standard conditions Fig. 2 from Skarie et al., 2009
central nervous system hemorrhagic, abnormal WT + MO2-foxc1a standard conditions Fig. 2 from Skarie et al., 2009
pronephric glomerulus physical object quality, abnormal ki1Tg + MO2-foxc1a standard conditions Fig. 3 from He et al., 2014
heart edematous, abnormal ki1Tg + MO2-foxc1a standard conditions Fig. 3 from He et al., 2014
vasculature development disrupted, abnormal s843Tg; sd2Tg + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
blood circulation disrupted, abnormal s843Tg; sd2Tg + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
intersegmental vessel decreased amount, abnormal s843Tg; sd2Tg + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
neural crest pdgfra expression decreased amount, abnormal foxc1bua1018/ua1018 + MO2-foxc1a (AB) standard conditions Fig. S2 with image from Umali et al., 2019
solid lens vesicle pdgfra expression decreased amount, abnormal foxc1bua1018/ua1018 + MO2-foxc1a (AB) standard conditions Fig. S2 with image from Umali et al., 2019
retinal ganglion cell layer pou4f2 expression decreased amount, abnormal foxc1bua1018/ua1018 + MO2-foxc1a (AB) standard conditions Fig. 4 with image from Umali et al., 2019
retina atoh7 expression absent, abnormal foxc1bua1018/ua1018 + MO2-foxc1a (AB) standard conditions Fig. 4 with image from Umali et al., 2019
cranial nerve II decreased diameter, abnormal foxc1bua1018/ua1018 + MO2-foxc1a (AB) standard conditions Fig. 3 with image from Umali et al., 2019
retina atoh7 expression decreased amount, abnormal foxc1bua1018/ua1018 + MO2-foxc1a (AB) standard conditions Fig. 4 with image from Umali et al., 2019
pharyngeal arch pdgfra expression decreased amount, abnormal foxc1bua1018/ua1018 + MO2-foxc1a (AB) standard conditions Fig. S2 with image from Umali et al., 2019
retinal ganglion cell neuron differentiation decreased occurrence, abnormal foxc1bua1018/ua1018 + MO2-foxc1a (AB) standard conditions Fig. 4 with image from Umali et al., 2019
retinal ganglion cell layer has fewer parts of type retinal ganglion cell, abnormal foxc1bua1018/ua1018 + MO2-foxc1a (AB) standard conditions Fig. 2 with image from Umali et al., 2019
head fgf19 expression decreased amount, abnormal foxc1bua1018/ua1018 + MO2-foxc1a (AB) standard conditions Fig. 5 with image from Umali et al., 2019
retina layer formation delayed, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
brain vasculature morphology, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. S2 from French et al., 2014
lens development in camera-type eye delayed, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
pericardium edematous, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2 from Skarie et al., 2009
periocular mesenchyme disorganized, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
eye hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2Fig. 8 from Skarie et al., 2009
blood circulation disrupted, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2 from Skarie et al., 2009
hyaloid vessel decreased amount, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
eye decreased size, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2Fig. 3 from Skarie et al., 2009
corneal stroma structure, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
central nervous system hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2Fig. 8 from Skarie et al., 2009
eye basement membrane disorganized, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 6 from Skarie et al., 2009
eye hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 7 from Acharya et al., 2011
eye apoptotic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 7 from Berry et al., 2008
hyaloid vessel dilated, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
ventricular system distended, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
eye basement membrane morphology, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 7 from Skarie et al., 2009
brain hydrocephalic, abnormal WT + MO1-foxc1b + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 7 from Acharya et al., 2011
whole organism decreased length, abnormal WT + MO1-foxc1b + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 7 from Acharya et al., 2011
neural crest cell migration delayed, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. S4 from French et al., 2014
brain hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 1Fig. 2 from French et al., 2014
hyaloid vessel morphology, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 6 from Skarie et al., 2009
brain hydrocephalic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2Fig. 8 from Skarie et al., 2009
corneal endothelium aplastic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
central nervous system hemorrhagic, abnormal sd2Tg/+ + MO1-foxc1b + MO1-pawr + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
eye hemorrhagic, abnormal sd2Tg/+ + MO1-foxc1b + MO1-pawr + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
brain hydrocephalic, abnormal WT + MO1-foxc1b + MO1-pawr + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
central nervous system hemorrhagic, abnormal WT + MO1-foxc1b + MO1-pawr + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
brain hemorrhagic, abnormal WT + MO1-foxc1b + MO1-pdgfrb + MO2-foxc1a standard conditions Fig. 2 from French et al., 2014
brain hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO2-pdgfra standard conditions Fig. 2 from French et al., 2014
central nervous system hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO5-lama1 standard conditions Fig. 8 from Skarie et al., 2009
eye hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO5-lama1 standard conditions Fig. 8 from Skarie et al., 2009
brain hydrocephalic, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO5-lama1 standard conditions Fig. 8 from Skarie et al., 2009
whole organism decreased length, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO7-pitx2 chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
brain hydrocephalic, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO7-pitx2 chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
pericardium edematous, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO7-pitx2 chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
brain decreased size, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO7-pitx2 chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
brain hemorrhagic, abnormal WT + MO1-foxc1b + MO1-pdgfrb + MO2-foxc1a + MO2-pdgfra standard conditions Fig. 2 from French et al., 2014
pronephric glomerulus physical object quality, abnormal ki1Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from He et al., 2014
heart edematous, abnormal ki1Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from He et al., 2014
pronephric glomerulus physical object quality, abnormal ki1Tg + MO1-lmx1bb + MO2-foxc1a standard conditions Fig. 3 from He et al., 2014
heart edematous, abnormal ki1Tg + MO1-lmx1bb + MO2-foxc1a standard conditions Fig. 3 from He et al., 2014
dorsal aorta morphology, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
intersegmental vessel increased branchiness, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 5 from Skarie et al., 2009
hyaloid vessel blood vessel endothelial cell disorganized, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
cardinal system morphology, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
vasculature broken, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
blood vessel endothelial cell disorganized, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 5 from Skarie et al., 2009
central nervous system hemorrhagic, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4Fig. 5 from Skarie et al., 2009
hyaloid vessel dilated, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
eye hemorrhagic, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4Fig. 5 from Skarie et al., 2009
hyaloid vessel branchiness, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
neural crest cell migration disrupted, abnormal zf15Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
eye decreased size, abnormal zf15Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
cerebellum vascular associated smooth muscle cell decreased amount, abnormal ca7Tg; ci5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from French et al., 2014
brain vasculature neural crest cell decreased amount, abnormal ci5Tg; zf566Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from French et al., 2014
axial vasculature decreased size, abnormal s843Tg; sd2Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
intersegmental vessel aplastic, abnormal s843Tg; sd2Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
blood circulation disrupted, abnormal s843Tg; sd2Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
vasculature development disrupted, abnormal s843Tg; sd2Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
blood circulation disrupted, abnormal s843Tg; sd2Tg + MO2-foxc1a + MO3-etsrp standard conditions Fig. 4 with image from De Val et al., 2008
vasculature development disrupted, abnormal s843Tg; sd2Tg + MO2-foxc1a + MO3-etsrp standard conditions Fig. 4 with image from De Val et al., 2008
Citations