Morpholino

MO1-notch3

ID
ZDB-MRPHLNO-041207-7
Name
MO1-notch3
Previous Names
  • MO-notch3-1 (1)
Target
Sequence
5' - ATATCCAAAGGCTGTAATTCCCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
designed to bind to 5'-end of gene
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-notch3
Phenotype
Phenotype resulting from MO1-notch3
No data available
Phenotype of all Fish created by or utilizing MO1-notch3
Phenotype Fish Conditions Figures
rhombomere boundary formation disrupted, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
neural tube morphology, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
hindbrain neuroepithelial cell aggregated, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
ectoderm development disrupted, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 4 with image from Hsiao et al., 2007
hindbrain neuron increased amount, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
hindbrain epithelium disorganized, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
hindbrain development disrupted, abnormal notch1ath35b/th35b + MO1-notch3 standard conditions Fig. 5 from Qiu et al., 2009
neural plate morphology, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 1 from Yeo et al., 2007
negative regulation of neurogenesis decreased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
Notch signaling pathway decreased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
central nervous system cellular quality, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Yeo et al., 2007
neurogenesis increased occurrence, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
neural plate development process quality, abnormal WT + MO1-notch1a + MO1-notch3 standard conditions Fig. 1 from Yeo et al., 2007
negative regulation of neurogenesis decreased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
Notch signaling pathway decreased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
neurogenesis increased occurrence, abnormal WT + MO1-nlk1 + MO1-notch1a + MO1-notch3 standard conditions Fig. 5 from Ishitani et al., 2010
peripheral neuron decreased length, abnormal knu2Tg + MO1-notch1a + MO1-notch3 + MO4-notch1b standard conditions Fig. 4 from So et al., 2009
dorsal aorta mural cell absent, abnormal ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
intersegmental vessel mural cell absent, abnormal ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
intersegmental vessel mural cell decreased amount, abnormal ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
intersegmental vessel mural cell decreased amount, exacerbated ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 chemical treatment by environment: DAPT Fig. 3 with image from Ando et al., 2019
hyaloid vessel mural cell decreased amount, abnormal ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
brain vasculature mural cell absent, abnormal ncv1Tg; ncv22Tg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
brain vasculature pericyte decreased amount, abnormal ncv1Tg; ncv34Tg; nkuasgfp1aTg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
brain vasculature pericyte absent, abnormal ncv1Tg; ncv34Tg; nkuasgfp1aTg + MO1-notch3 + MO2-notch2 standard conditions Fig. 3 with image from Ando et al., 2019
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b control Fig. 3 with image from Chen et al., 2017
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b control Fig. 3 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-notch3 + MO2-notch1b control Fig. 3 with image from Chen et al., 2017
Citations