CRISPR

CRISPR1-jak3

ID

ZDB-CRISPR-231214-3

Name

CRISPR1-jak3

Previous Names

None

Target

jak3 (1)

Sequence

5' - GGAGATTTGACTCATCAAAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mdu10	jak3
mdu9	jak3
zf3747	jak3

Expression

Gene expression in Wild Types + CRISPR1-jak3

No data available

Phenotype

Phenotype resulting from CRISPR1-jak3

No data available

Phenotype of all Fish created by or utilizing CRISPR1-jak3

Phenotype	Fish	Conditions	Figures
kidney leukocyte infiltrative, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 5 from Basheer et al., 2022
kidney ighm expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
kidney lmo2 expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
intestine neoplastic, invasive, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 5 from Basheer et al., 2022
kidney ighd expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
brain neoplastic, invasive, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 5 from Basheer et al., 2022
blood lymphocyte decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
kidney neoplastic, invasive, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 5 from Basheer et al., 2022
kidney nkl.4 expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
whole organism cd8a expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 3 from Basheer et al., 2022
whole organism cd4-1 expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 3 from Basheer et al., 2022
thymus trac expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 2 from Basheer et al., 2022
kidney mpx expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
kidney cd8a expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
whole organism ighv4-6 expression absent, abnormal	jak3^mdu9/mdu9	standard conditions	Fig. S2 from Basheer et al., 2022
thymus trac expression decreased distribution, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 2 from Basheer et al., 2022
kidney myeloid cell decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
thymus rag1 expression decreased distribution, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 2 from Basheer et al., 2022
blood neutrophil increased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
liver leukocyte infiltrative, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 5 from Basheer et al., 2022
liver neoplastic, invasive, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 5 from Basheer et al., 2022
kidney trac expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
kidney cd4-1 expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
brain leukocyte infiltrative, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 5 from Basheer et al., 2022
thymus ikzf1 expression decreased distribution, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 2 from Basheer et al., 2022
whole organism ighv1-1 expression absent, abnormal	jak3^mdu9/mdu9	standard conditions	Fig. S2, Figure 3 from Basheer et al., 2022
thymus ikzf1 expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 2 from Basheer et al., 2022
thymus rag1 expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 2 from Basheer et al., 2022
intestine leukocyte infiltrative, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 5 from Basheer et al., 2022
kidney nccrp1 expression decreased amount, abnormal	jak3^mdu9/mdu9	standard conditions	Figure 4 from Basheer et al., 2022
thymus rag1 expression decreased distribution, abnormal	jak3^mdu10/mdu10	standard conditions	Fig. S2 from Basheer et al., 2022

Citations