CRISPR

CRISPR2-foxj1b

ID

ZDB-CRISPR-221221-7

Name

CRISPR2-foxj1b

Previous Names

None

Target

foxj1b (1)

Sequence

5' - GGTCCACCCGCAATATTACG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
sq5719	foxj1b

Expression

Gene expression in Wild Types + CRISPR2-foxj1b

No data available

Phenotype

Phenotype resulting from CRISPR2-foxj1b

No data available

Phenotype of all Fish created by or utilizing CRISPR2-foxj1b

Phenotype	Fish	Conditions	Figures
olfactory epithelium decreased size, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
whole organism cnga4 expression decreased amount, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig 3 from Rayamajhi et al., 2024
dorsal telencephalon lacks all parts of type ciliated cell, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig. 5 from D'Gama et al., 2021
olfactory epithelium has fewer parts of type ciliated olfactory receptor neuron 9+2 non-motile cilium, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
choroid plexus lacks parts or has fewer parts of type single ciliated epithelial cell, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig. 5 from D'Gama et al., 2021
telencephalic ventricle increased size, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig. 7 from D'Gama et al., 2021
ciliated olfactory receptor neuron non-motile cilium assembly decreased process quality, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
olfactory pit has fewer parts of type multi-ciliated epithelial cell motile cilium, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
olfactory pit decreased size, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
whole organism ompb expression decreased amount, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig 3 from Rayamajhi et al., 2024
multi-ciliated epithelial cell differentiation decreased process quality, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
olfactory epithelium ciliated olfactory receptor neuron poorly differentiated, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig 3 from Rayamajhi et al., 2024
multi-ciliated epithelial cell motile cilium assembly decreased process quality, abnormal	foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
olfactory pit ab1-tuba labeling absent, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
olfactory epithelium decreased size, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
olfactory epithelium has fewer parts of type ciliated olfactory receptor neuron 9+2 non-motile cilium, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
olfactory epithelium ompb expression decreased amount, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 3 from Rayamajhi et al., 2024
olfactory pit decreased size, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
olfactory pit lacks all parts of type multi-ciliated epithelial cell motile cilium, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
ciliated olfactory receptor neuron non-motile cilium assembly decreased process quality, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
multi-ciliated epithelial cell differentiation decreased process quality, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
brain motile cilium absence of anatomical entity, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 5 from D'Gama et al., 2021
olfactory epithelium cnga4 expression decreased amount, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 3 from Rayamajhi et al., 2024
olfactory epithelium ciliated olfactory receptor neuron poorly differentiated, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 3 from Rayamajhi et al., 2024
multi-ciliated epithelial cell motile cilium assembly decreased process quality, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}	standard conditions	Fig 2 from Rayamajhi et al., 2024
olfactory epithelium GCaMP expression decreased amount, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}; jf4Tg	chemical treatment by environment: bile acid	Fig 4 from Rayamajhi et al., 2024
sensory perception of smell decreased process quality, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}; jf4Tg	control	Fig 4 from Rayamajhi et al., 2024
sensory perception of smell decreased process quality, abnormal	foxj1a^{sq5717/sq5717}; foxj1b^{sq5719/sq5719}; jf4Tg	chemical treatment by environment: bile acid	Fig 4 from Rayamajhi et al., 2024
choroid plexus motile cilium decreased amount, abnormal	gmnc^sq34/sq34; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 5 from D'Gama et al., 2021
tela chorioidea motile cilium decreased amount, abnormal	gmnc^sq34/sq34; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 5 from D'Gama et al., 2021
vertebral column rotational curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/+; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 7 from D'Gama et al., 2021
vertebral column increased curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/+; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 7 from D'Gama et al., 2021
vertebral column rotational curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/sq34; foxj1b^sq5719/+	standard conditions	Fig. 7 from D'Gama et al., 2021
vertebral column increased curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/sq34; foxj1b^sq5719/+	standard conditions	Fig. 7 from D'Gama et al., 2021
vertebral column increased curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/sq34; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 7 from D'Gama et al., 2021
vertebral column rotational curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/sq34; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 7 from D'Gama et al., 2021

Citations