CRISPR

CRISPR3-smchd1

ID
ZDB-CRISPR-221220-32
Name
CRISPR3-smchd1
Previous Names
None
Target
Sequence
5' - TACGAGTATTACGCCAGCGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ns301 smchd1
ns302 smchd1
ns303 smchd1
Expression
Gene expression in Wild Types + CRISPR3-smchd1
No data available
Phenotype
Phenotype resulting from CRISPR3-smchd1
No data available
Phenotype of all Fish created by or utilizing CRISPR3-smchd1
Phenotype Fish Conditions Figures
vertebra decreased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 3 with image from Xue et al., 2022
oocyte hoxd10a expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 3 with image from Xue et al., 2022
whole organism Ab3-smchd1 labeling absent, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 1 with image from Xue et al., 2022
oocyte epigenetic programming of gene expression decreased process quality, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 3 with image from Xue et al., 2022
tail bud hoxc10a expression increased distribution, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 2 with image from Xue et al., 2022
oocyte hoxb2a expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 3 with image from Xue et al., 2022
whole organism hoxc11b expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 2 with image from Xue et al., 2022
oocyte hoxb7a expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 3 with image from Xue et al., 2022
whole organism hoxd10a expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 2 with image from Xue et al., 2022
rhombomere 5 hoxb2a expression mislocalised, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 2 with image from Xue et al., 2022
whole organism smchd1 expression decreased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 1 with image from Xue et al., 2022
oocyte hoxc10a expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 3 with image from Xue et al., 2022
vertebra decreased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Xue et al., 2022
oocyte hoxc11a expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 3 with image from Xue et al., 2022
oocyte hoxa3a expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 3 with image from Xue et al., 2022
whole organism hoxb2a expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 2 with image from Xue et al., 2022
whole organism hoxc10a expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 2 with image from Xue et al., 2022
whole organism smchd1 expression absent, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 1 with image from Xue et al., 2022
oocyte hoxc8a expression increased amount, abnormal smchd1ns301/ns301 (AB) standard conditions Fig. 3 with image from Xue et al., 2022
whole organism smchd1 expression decreased amount, abnormal smchd1ns302/ns302 (AB) standard conditions Fig. 1 with image from Xue et al., 2022
vertebra decreased amount, abnormal smchd1ns302/ns302 (AB) standard conditions Fig. 2 with image from Xue et al., 2022
whole organism smchd1 expression absent, abnormal smchd1ns302/ns302 (AB) standard conditions Fig. 1 with image from Xue et al., 2022
oocyte smchd1 expression absent, abnormal smchd1ns303/ns303 (AB) standard conditions Fig. 3 with image from Xue et al., 2022
vertebra decreased amount, abnormal smchd1ns303/ns303 (AB) standard conditions Fig. 2 with image from Xue et al., 2022
whole organism smchd1 expression decreased amount, abnormal smchd1ns303/ns303 (AB) standard conditions Fig. 1 with image from Xue et al., 2022
whole organism smchd1 expression absent, abnormal smchd1ns303/ns303 (AB) standard conditions Fig. 1 with image from Xue et al., 2022
oocyte hoxb7a expression increased amount, abnormal smchd1ns301/+ (AB) standard conditions Fig. 3 with image from Xue et al., 2022
vertebra decreased amount, abnormal smchd1ns301/+ (AB) standard conditions Fig. 3 with image from Xue et al., 2022
whole organism smchd1 expression decreased amount, abnormal smchd1ns301/+ (AB) standard conditions Fig. 3 with image from Xue et al., 2022
oocyte hoxd10a expression increased amount, abnormal smchd1ns301/+ (AB) standard conditions Fig. 3 with image from Xue et al., 2022
oocyte hoxc10a expression increased amount, abnormal smchd1ns301/+ (AB) standard conditions Fig. 3 with image from Xue et al., 2022
oocyte hoxc11a expression increased amount, abnormal smchd1ns301/+ (AB) standard conditions Fig. 3 with image from Xue et al., 2022
oocyte hoxa3a expression increased amount, abnormal smchd1ns301/+ (AB) standard conditions Fig. 3 with image from Xue et al., 2022
vertebra decreased amount, abnormal lrif1ns304/ns304; smchd1ns301/ns301 (AB) standard conditions Fig. 5 with image from Xue et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.