CRISPR

CRISPR2-mia3

ID

ZDB-CRISPR-211028-4

Name

CRISPR2-mia3

Previous Names

None

Target

mia3 (1)

Sequence

5' - ATCTGAAGTCGATGAGTCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mw92	mia3

Expression

Gene expression in Wild Types + CRISPR2-mia3

No data available

Phenotype

Phenotype resulting from CRISPR2-mia3

No data available

Phenotype of all Fish created by or utilizing CRISPR2-mia3

Phenotype	Fish	Conditions	Figures
chondrocyte endoplasmic reticulum distended, abnormal	mia3^mw92/mw92	standard conditions	Fig. 3 from Clark et al., 2021
cranial cartilage deformed, abnormal	mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
pharyngeal arch cartilage ab1-col2a labeling spatial pattern, abnormal	mia3^mw92/mw92	standard conditions	Fig. 3 from Clark et al., 2021
head deformed, abnormal	mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
whole organism dead, abnormal	mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
mouth decreased length, abnormal	mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
whole organism decreased life span, abnormal	mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
caudal vein accumulation nucleate erythrocyte, abnormal	mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
intersegmental vessel lipoprotein transport decreased process quality, abnormal	mia3^mw92/mw92	standard conditions	Fig. 3 from Clark et al., 2021
ventral mandibular arch d2EGFP expression increased amount, abnormal	mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 5 from Clark et al., 2021
head deformed, abnormal	mia2^mw91/+; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
mouth decreased length, abnormal	mia2^mw91/+; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
whole organism dead, abnormal	mia2^mw91/+; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
whole organism decreased life span, abnormal	mia2^mw91/+; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
pharyngeal arch cartilage ab1-col2a labeling spatial pattern, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 3 from Clark et al., 2021
chondrocyte endoplasmic reticulum distended, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 3 from Clark et al., 2021
whole organism decreased weight, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 1 from Clark et al., 2021
whole organism decreased length, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 1 from Clark et al., 2021
intersegmental vessel lipoprotein transport decreased process quality, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 3 from Clark et al., 2021
yolk low brightness, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 1 from Clark et al., 2021
caudal vein increased accumulation nucleate erythrocyte, exacerbated	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
sclera apoptotic process increased process quality, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
lens degenerate, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
head deformed, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
whole organism dead, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
mouth decreased length, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
heart anatomical structure quality, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
cranial cartilage absent, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
lens apoptotic process increased process quality, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
whole organism decreased life span, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
cranial cartilage morphology, exacerbated	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
brain apoptotic process increased process quality, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 4 from Clark et al., 2021
yolk low brightness, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
spinal cord cell decreased amount, abnormal	mia2^mw91/mw91; mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 4 from Clark et al., 2021
trunk muscle d2EGFP expression increased amount, abnormal	mia2^mw91/mw91; mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 5 from Clark et al., 2021
ventral mandibular arch d2EGFP expression increased amount, abnormal	mia2^mw91/mw91; mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 5 from Clark et al., 2021
spinal cord d2EGFP expression increased amount, abnormal	mia2^mw91/mw91; mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 4 from Clark et al., 2021
spinal cord d2EGFP expression increased distribution, abnormal	mia2^mw91/mw91; mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 4 from Clark et al., 2021

Citations