CRISPR

CRISPR1-mia3

ID
ZDB-CRISPR-211028-3
Name
CRISPR1-mia3
Previous Names
None
Target
Sequence
5' - TGGCTGCACCGAATAATCCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mw92 mia3
Expression
Gene expression in Wild Types + CRISPR1-mia3
No data available
Phenotype
Phenotype resulting from CRISPR1-mia3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-mia3
Phenotype Fish Conditions Figures
chondrocyte endoplasmic reticulum distended, abnormal mia3mw92/mw92 standard conditions Fig. 3 with image from Clark et al., 2021
cranial cartilage deformed, abnormal mia3mw92/mw92 standard conditions Fig. 2 with image from Clark et al., 2021
pharyngeal arch cartilage ab1-col2a labeling spatial pattern, abnormal mia3mw92/mw92 standard conditions Fig. 3 with image from Clark et al., 2021
head deformed, abnormal mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
whole organism dead, abnormal mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
mouth decreased length, abnormal mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
whole organism decreased life span, abnormal mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
caudal vein accumulation nucleate erythrocyte, abnormal mia3mw92/mw92 standard conditions Fig. 2 with image from Clark et al., 2021
intersegmental vessel lipoprotein transport decreased process quality, abnormal mia3mw92/mw92 standard conditions Fig. 3 with image from Clark et al., 2021
ventral mandibular arch d2EGFP expression increased amount, abnormal mia3mw92/mw92; mw85Tg standard conditions Fig. 5 with image from Clark et al., 2021
head deformed, abnormal mia2mw91/+; mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
mouth decreased length, abnormal mia2mw91/+; mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
whole organism dead, abnormal mia2mw91/+; mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
whole organism decreased life span, abnormal mia2mw91/+; mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
pharyngeal arch cartilage ab1-col2a labeling spatial pattern, abnormal mia2mw91/mw91; mia3mw92/+ standard conditions Fig. 3 with image from Clark et al., 2021
chondrocyte endoplasmic reticulum distended, abnormal mia2mw91/mw91; mia3mw92/+ standard conditions Fig. 3 with image from Clark et al., 2021
whole organism decreased weight, abnormal mia2mw91/mw91; mia3mw92/+ standard conditions Fig. 1 with image from Clark et al., 2021
whole organism decreased length, abnormal mia2mw91/mw91; mia3mw92/+ standard conditions Fig. 1 with image from Clark et al., 2021
intersegmental vessel lipoprotein transport decreased process quality, abnormal mia2mw91/mw91; mia3mw92/+ standard conditions Fig. 3 with image from Clark et al., 2021
yolk low brightness, abnormal mia2mw91/mw91; mia3mw92/+ standard conditions Fig. 1 with image from Clark et al., 2021
caudal vein increased accumulation nucleate erythrocyte, exacerbated mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 2 with image from Clark et al., 2021
sclera apoptotic process increased process quality, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 2 with image from Clark et al., 2021
lens degenerate, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 2 with image from Clark et al., 2021
head deformed, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
whole organism dead, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
mouth decreased length, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
heart anatomical structure quality, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 2 with image from Clark et al., 2021
cranial cartilage absent, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 2 with image from Clark et al., 2021
lens apoptotic process increased process quality, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 2 with image from Clark et al., 2021
whole organism decreased life span, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
cranial cartilage morphology, exacerbated mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 2 with image from Clark et al., 2021
brain apoptotic process increased process quality, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 4 with image from Clark et al., 2021
yolk low brightness, abnormal mia2mw91/mw91; mia3mw92/mw92 standard conditions Fig. 1 with image from Clark et al., 2021
spinal cord cell decreased amount, abnormal mia2mw91/mw91; mia3mw92/mw92; mw85Tg standard conditions Fig. 4 with image from Clark et al., 2021
trunk muscle d2EGFP expression increased amount, abnormal mia2mw91/mw91; mia3mw92/mw92; mw85Tg standard conditions Fig. 5 with image from Clark et al., 2021
ventral mandibular arch d2EGFP expression increased amount, abnormal mia2mw91/mw91; mia3mw92/mw92; mw85Tg standard conditions Fig. 5 with image from Clark et al., 2021
spinal cord d2EGFP expression increased amount, abnormal mia2mw91/mw91; mia3mw92/mw92; mw85Tg standard conditions Fig. 4 with image from Clark et al., 2021
spinal cord d2EGFP expression increased distribution, abnormal mia2mw91/mw91; mia3mw92/mw92; mw85Tg standard conditions Fig. 4 with image from Clark et al., 2021
Citations