CRISPR

CRISPR1-sox3

ID
ZDB-CRISPR-180705-3
Name
CRISPR1-sox3
Previous Names
None
Target
Sequence
5' - ACGACCAGGACCGGGTGAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
x52 sox3
x53 sox3
Expression
Gene expression in Wild Types + CRISPR1-sox3
No data available
Phenotype
Phenotype resulting from CRISPR1-sox3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sox3
Phenotype Fish Conditions Figures
otic placode pax2a expression decreased distribution, abnormal sox3x52/x52 (AB) standard conditions Fig. 3 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased distribution, abnormal sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
otic placode sox2 expression increased amount, abnormal sox3x52/x52 (AB) standard conditions Fig. 2 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression spatial pattern, abnormal sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased amount, abnormal sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
statoacoustic (VIII) ganglion neuron decreased amount, abnormal sox3x52/x52 (AB) standard conditions Fig. 2 with image from Gou et al., 2018
otic placode sox2 expression increased distribution, abnormal sox3x52/x52 (AB) standard conditions Fig. 2 with image from Gou et al., 2018
otic placode pax8 expression decreased distribution, abnormal sox3x52/x52 (AB) standard conditions Fig. 3 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression spatial pattern, abnormal sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression absent, abnormal sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression absent, abnormal sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased distribution, abnormal sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
otic vesicle decreased size, abnormal sox3x52/x52 (AB) standard conditions Fig. 1 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased amount, abnormal sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression spatial pattern, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
epibranchial placode pax2a expression decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
otic placode pax2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 3 with image from Gou et al., 2018
auditory receptor cell decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 2 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression spatial pattern, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
statoacoustic (VIII) ganglion neuron decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 2 with image from Gou et al., 2018
epibranchial placode pax2a expression spatial pattern, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
otic placode pax8 expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 3 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression spatial pattern, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
epibranchial placode pax2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression decreased distribution, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression decreased amount, abnormal sox2x50/x50; sox3x52/x52 (AB) standard conditions Fig. 4 with image from Gou et al., 2018
otic placode pax2a expression decreased distribution, abnormal sox3x52/x52; pax8nia03Gt/nia03Gt (AB) standard conditions Fig. 5 with image from Gou et al., 2018
otic placode pax2a expression decreased amount, abnormal sox3x52/x52; pax8nia03Gt/nia03Gt (AB) standard conditions Fig. 5 with image from Gou et al., 2018
Citations