CRISPR

CRISPR1-hspe1

ID

ZDB-CRISPR-160128-31

Name

CRISPR1-hspe1

Previous Names

Z000042 (1)

Target

hspe1 (2)

Sequence

5' - GGCAGGCTACCGTGGTAGCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

CRISPRz:Z000042 (1)

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hg76	hspe1
hg77	hspe1

Expression

Gene expression in Wild Types + CRISPR1-hspe1

No data available

Phenotype

Phenotype resulting from CRISPR1-hspe1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-hspe1

Phenotype	Fish	Conditions	Figures
whole organism decreased length, abnormal	hspe1^hg76/hg76	standard conditions	Fig. 2 from Pei et al., 2018
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal	hspe1^hg76/hg76	chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell	Fig. 3 from Pei et al., 2018
neuromast hair cell regeneration disrupted, abnormal	hspe1^hg76/hg76	chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell	Fig. 3 from Pei et al., 2018
swim bladder increased variability of size, abnormal	hspe1^hg76/hg76	standard conditions	Fig. 2 from Pei et al., 2018
swim bladder uninflated, abnormal	hspe1^hg76/hg76	standard conditions	Fig. 2 from Pei et al., 2018
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal	hspe1^hg77/hg77	chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell	Fig. 3 from Pei et al., 2018
neuromast hair cell regeneration disrupted, abnormal	hspe1^hg77/hg77	chemical treatment by environment: copper(II) sulfate, chemical ablation: neuromast hair cell	Fig. 3 from Pei et al., 2018
whole organism decreased length, abnormal	hspe1^hg77/hg77	standard conditions	Fig. 2 from Pei et al., 2018
swim bladder increased variability of size, abnormal	hspe1^hg77/hg77	standard conditions	Fig. 2 from Pei et al., 2018
swim bladder uninflated, abnormal	hspe1^hg77/hg77	standard conditions	Fig. 2 from Pei et al., 2018
liver decreased size, abnormal	hspe1^hg76/hg76; s931Tg/+	chemical ablation: liver, chemical treatment: metronidazole	Fig. 5 from Pei et al., 2018
liver regeneration disrupted, abnormal	hspe1^hg76/hg76; s931Tg/+	chemical ablation: liver, chemical treatment: metronidazole	Fig. 5 from Pei et al., 2018
liver regeneration disrupted, abnormal	hspe1^hg77/hg77; s931Tg/+	chemical ablation: liver, chemical treatment: metronidazole	Fig. 5 from Pei et al., 2018
liver decreased size, abnormal	hspe1^hg77/hg77; s931Tg/+	chemical ablation: liver, chemical treatment: metronidazole	Fig. 5 from Pei et al., 2018
liver decreased size, abnormal	hspe1^hg77/hg77; s931Tg/+	standard conditions	Fig. S7 from Pei et al., 2018

Citations